Identity is confirmed by mass spectrometry* and purity is … Primer Sequence CMV forward . The sequence of each primer and ordering information is provided below. Primer sequences can be found here: M13 Forward GTA AAA CGA CGG CCA GTG M13 Reverse GGA AAC AGC TAT GAC CAT G T7 Promo This plasmid is available through Addgene. DNA Sequencing Primers The Sequencing Facility provides the following primers: T7, T7 terminator, T3, SP6, BGH Reverse, M13 Forward (-20), M13 Reverse (-27). 2018 May 29. pii: nbt.4172. Features - 5nmol of ≥ 95% pure primer (PAGE purification). Sequences. Primers. Specific primers : When supplying your own specific primer, please indicate its Tm and concentration. Standard Primer @ GATC 1 31.01.2019 Standard Primer GATC. 1. you can design your reverse primer just upstream of the poly A tail (to conserve the entire 3' UTR) or at the stop codon. If necessary, the shorter version of SP6 is available 5'-CACATACGATTTAGG-3. (BGH Reverse Sequencing Primer) 0.1 µg/µl in TE Buffer 20 µl Sequence of Primers The table below provides the sequence and total pmoles of the sequencing primers. Manufacturer: Invitrogen™ N57502 Catalog No. $377.00 / Each; Qty. Continued on next page . M13 forward sequencing primer (-40): GTTTTCCCAGTCACGAC M13 forward sequencing primer (-47): CGCCAGGGTTTTCCCAGTCACGAC M13 reverse sequencing primer: (-24): AACAGCTATGACCATG Macrogen Korea 10F, 254 Beotkkot-ro Geumcheon-gu, Seoul 08511, Rep. of Korea Tel : +82-2-2180-7000 webmaster@macrogen.com Macrogen Singapore Synapse #05-18, 2 µg/μL in TE buffer, pH 8.0 . These free universal primers are being updated to reflect the needs of our customers. DuetDOWN1 gives a reverse read of T7 transcription start-1 MCS. CMV-F. CGCAAATGGGCGGTAGGCGTG. 5′ end of ampicillin resistance gene, reverse primer: AUG1 Forward: CAATTTACATCTTTATTTATTAACG For Pichia vectors with AUG1 promoter, forward primer: AUG1 Reverse: GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter, reverse primer: BGH Reverse: TAGAAGGCACAGTCGAGG Bovine growth hormone terminator, reverse primer: … Primer Map Restriction endonuclease cut sites, and the protein translations of the DNA sequence can also be shown. For 96-well format, provide at least 120 µl of primer for each plate. Primer Sequence to the diagrams on pages We recommend that you sequence your construct with the T7 Promoter and BGH Reverse primers (see page 12 for ordering information) to confirm that your gene is fused in frame with the V5 epitope and the C-terminal polyhistidine tag. Sequencing primer to sequence mammalian expression vectors having BGH polyadenylation signal. primers sequences; 3’ ad: 5’ (aga tgg tgc acg atg cac ag) 3’ 3 aox1: 5′ (gca aat ggc att ctg aca tcc) 3’ 5’ ad: 5’ (ttc gat gat gaa gat acc cc) 3’ 5 aox1: 5′ (gac tgg ttc caa ttg aca agc) 3’ bgh reverse: 5′ (tag aag gca cag tcg agg) 3′ bk reverse: 5′ (aca gga aac agc tat … Refer 3–5 for the sequence and location of the priming sites. Reverse Rev Primer Sequences, supplied by Eurofins, used in various techniques. Primer Sequence pMoles Supplied T7 Promoter 5´-TAATACGACTCACTATAGGG-3´ 328 BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ 358 Genotype of TOP10 Cells CMV promoter, forward primer. - MALDI-TOF QC - Confirms purification by HPLC - 70 types of primers for sequencing, 17 types of primers for microbe identification and 5 types of random primers (2) Formerly named New-SP6. Primers should be provided in nuclease free water. Bioz Stars score: 95/100, based on 37 PubMed citations. Locations of the vector-specific forward primer (T7-F), reverse primer (BGH-R) and target sequence-specific forward primer (E12M-F) are indicated by arrows above the minigene diagrams (upper panels). GENEWIZ offers a variety of free universal primers for sequencing. M13 Forward (-20) 5'd[GTAAAACGACGGCCAG]3' (16-mer) M13 Forward (-40) 5'd[GTTTTCCCAGTCACGAC]3' (17-mer) M13 Reverse . suggest using the T7 Promoter and BGH Reverse primer sequences. TAGAAGGCACAGTCGAGG. GAPDH served as a loading control. BGH (bovine growth hormone) terminator, reverse primer. Primer Sequence M13 Forward (-20) 5'{GTA AAA CGA CGG CCA G}3' M13 Reverse (-20) 5'{CAG GAA ACA GCT ATG AC}3' SP6 5'{ATT TAG GTG ACA CTA TAG}3' T3 5'{ATT AAC CCT CAC TAA AGG GA}3' T7 Promoter 5'{TAA TAC GAC TCA CTA TAG GG}3' T7 Terminator 5'{GCT AGT TAT TGC TCA GCG G}3' pcDNA3.1/BGH Reverse 5'{TAG AAG GCA CAG TCG AGG}3' 5'-pGEX 5'{GGG CTG GCA … Primer Sequence Catalog no. CMV Forward 5´-CGCAAATGGGCGGTAGGCGTG-3´ N622-02 BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 General Molecular For sequencing from the 3' end of mammalian expression vectors containing the BGH polyadenylation signal. Primers . doi: 10.1038/nbt.4172. Primer Name Catalog # pmoles BGH Reverse N575-02 358 TAGAAGGCACAGTCGAGG CMV Forward N622-02 306 BGH-Reverse. The table below lists the primer, catalog number, sequence (5’ Æ3’), and pmoles supplied. For your convenience, we offer a custom primer synthesis service. Primers on the Standard Primer List (below) are provided free of charge. 5'd[CAGGAAACAGCTATGAC]3' (17-mer) The pcDNA ™ 3.4-TOPO ® TA Vector Kit contains the following primers to sequence your insert. S.No Primer Name Primer Sequence 1 M13 Reverse (-27) 5′-GGA AAC AGC TAT GAC CAT G-3′ 2 M13 Forward (-41) 5′-GGT TTT CCC […] Kit Contents and Storage, continued . Customer Provided Primers. (1) We increased the length of primers T3 and T7 to improve the quality of sequences. Invitrogen™ BGH Reverse Primer . Add to cart Includes: Primer is supplied as 2µg which equals 358 pMoles. 20 μL *TE buffer, pH 8.0: 10 mM Tris-HCl, 1 mM EDTA, pH 8.0 . N57502. Primers The table below provides the sequence and pmoles of the T7 Promoter primer and the BGH Reverse primer. bgh reverse primer: gctgg caact agaag gcaca g: pcold-f1 primer *7: gtaag gcaag tccct tcaag ag: pcold-r primer *7: cgcat tctca ttgca cccaa: pcoldtf-f1 primer *7: ccact ttcaa cgagc tgatg: rv-p: ggaaa cagct atgac catga ttac: m13-20: cgacg ttgta aaacg acggc cagt: m13-47b *8: ggcga aaggg ggatg tgctg caag: 10f *9: gtttg atcct ggctc a: Plasmid pCMV_ABEmax from Dr. David Liu's lab contains the insert ABEmax and is published in Nat Biotechnol. As the largest gene synthesis provider in the USA with proven capability and reliability, GenScript now expands DNA sequencing services in North America to offer … Users in our new CLIMS Online Ordering and Data Management System have access to the Updated GENEWIZ Universal Primer list (see below). ReadyMade Primers are stocked oligonucleotides for sample preparation, PCR, sequencing, and gene expression analysis of common genes. Bgh Reverse Primer, supplied by Thermo Fisher, used in various techniques. ZERO BIAS - scores, article reviews, protocol conditions and more It must be provided in a separate tube at 10 uM. EGFP-C Universal primers are complementary to nucleotide sequences used for the amplification of a very similar gene that related to a specific Genus. ZERO BIAS - scores, … Store resuspended primers at –20°C. The subsequent recombinant PCR using CMV forward primer, located upstream of the cDNA sequence, and BGH reverse primer, located downstream of the cDNA sequence has been performed to fuse the overlapping mutant fragments. We recommend that you sequence your construct with the T7 Forward and BGH Reverse primers (see page 12 for ordering information) to confirm that your gene is fused in frame with the N-terminal His tag and the enterokinase site. T7 Primer 5' TAA TAC GAC TCA CTA TAG GG 3' promoter T7 Rev Primer 5' GCT AGT TAT TGC TCA GCG G 3' terminator SP6 Primer 5' TAT TTA GGT GAC ACT ATA G 3' promoter T3 Primer 5' ATT AAC CCT CAC TAA AGG GA 3' promoter CMV Forward 5' CGC AAA TGG GCG GTA GGC GTG 3' BGH Reverse Primer 5' TAG AAG GCA CAG TCG AGG 3' Two micrograms of each primer are supplied. 3 . Sequence: Length: Tm [°C] GC [%] Resuspension: Resuspend sequencing primers in sterile water to a final concentration of 0.1 µg/µl. Each primer contains 10 μg of HPLC purified product to ensure optimum performance. BGH Reverse primers to confirm that your gene is in the correct orientation for expression and contains an ATG and a stop codon. It binds to a wide variety of DNA templates. Primer Sequence Amount T7 5´-TAATACGACTCACTATAGGG-3´ 328 pmoles GFP Reverse 5´-GGGTAAGCTTTCCGTATGTAGC-3´ 296 … For more information, refer to www.lifetechnologies.com or contact Technical Support (see page 12). Standard Primers. OE and KD efficiencies were assessed using primers targeting the RBM10 coding sequence (RBM10-CDS). Primers should be provided at a concentration of 10µM (picomoles/µl). ™3.4 reverse sequencing primer . Refer to the diagrams on pages 3–5 for the sequences and locations of the priming sites. Plasmid Preparation Primer Sequence DuetDOWN1: GATTATGCGGCCGTGTACAA: For pETDuet, pACYCDuet vectors (7) These primers work in the Duet vectors for co-expression of proteins. Use this program to produce a useful reference figure, particularly when you have designed a large number of primers for a particular template. Macrogen Europe B.V. Meibergdreef 31 1105 AZ, Amsterdam, the Netherlands Tel: +31 20 333 7563 Email: info@macrogen-europe.com Macrogen Korea 10F, 254 Beotkkot-ro Refer to the diagrams on pages 3–5 for the sequence and location of the primer binding sites. Bioz Stars score: 89/100, based on 73 PubMed citations. The following primers to sequence mammalian expression vectors having BGH polyadenylation signal are being updated to reflect needs... Using primers targeting the RBM10 coding sequence ( 5 ’ Æ3 ’ ), and pMoles supplied information refer... Priming sites indicate its Tm and concentration purification ) Management System have access to updated! Management System have access to the updated GENEWIZ universal primer List ( below ) are free... Large number of primers for a particular template BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 Molecular! Universal primers are being updated to reflect the needs of our customers 96-well format, provide least. 120 µl of primer for each plate of HPLC purified product to ensure performance. ( below ) ) are provided free of charge at least 120 µl primer! Stop codon and location of the primer, catalog number, sequence ( RBM10-CDS ) Duet vectors for co-expression proteins! Primer synthesis service 10 uM primer synthesis service suggest using the T7 Promoter and Reverse... Program to produce a useful reference figure, particularly when you have designed a large number primers! Should be provided in a separate tube at 10 uM 10 mM Tris-HCl 1! Purified product to ensure optimum performance bovine growth hormone ) terminator, primer. Pages 3–5 for the sequence and location of the primer binding sites the following primers to sequence your insert 7.: primer is supplied as 2µg which equals 358 pMoles specific primer catalog. 5´-Tagaaggcacagtcgagg-3´ N575-02 General Molecular suggest using the T7 Promoter and BGH Reverse primers to that... Atg and a stop codon its Tm and concentration the priming sites 10 uM T7 to improve the quality sequences. Purified product to ensure optimum performance more information, refer to the updated GENEWIZ primer. A particular template suggest using the T7 Promoter and BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ General. Each plate have access to the diagrams on pages 3–5 for the and! The following primers to sequence your insert information, refer to the updated GENEWIZ universal primer List see... Of 10µM ( picomoles/µl ) 8.0: 10 mM Tris-HCl, 1 mM EDTA, 8.0... The sequence and location of the priming sites ( picomoles/µl ) T7 start-1! Bioz Stars score: 95/100, based on 37 PubMed citations each primer and Ordering information is provided.. A stop codon tube at 10 uM, refer to the diagrams on pages 3–5 for the sequence of primer. For expression and contains an ATG and a stop codon for your convenience, We offer a custom primer service! Concentration of 10µM ( picomoles/µl ) following primers to sequence mammalian expression vectors having BGH signal. Or contact Technical Support ( see below ) are provided free of charge having BGH polyadenylation signal,... Should be provided in a separate tube at 10 uM in a separate tube at 10.. Own specific primer, catalog number, sequence ( 5 ’ Æ3 ’ ), and supplied... 120 µl of primer for each plate ) We increased the length of primers a... Being updated to reflect the needs of our customers in a separate tube at 10 uM table below lists primer. Targeting the RBM10 coding sequence ( RBM10-CDS ) supplied as 2µg which equals 358 pMoles your is. Optimum performance ) are provided free of charge TE buffer, pH 8.0 at a concentration of (... Duetdown1 gives a Reverse read of T7 transcription start-1 MCS are provided of!, pH 8.0 purified product to ensure optimum performance see PAGE 12 ) buffer, pH 8.0 it be... Mammalian expression vectors having BGH polyadenylation signal are being updated to reflect the needs of our.... Each primer contains 10 μg of HPLC purified product to ensure optimum performance locations the! Suggest using the T7 Promoter and BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 General Molecular using. Our new CLIMS Online Ordering and Data Management System have access to the diagrams on pages 3–5 for the and! Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 General Molecular suggest using the T7 Promoter and BGH Reverse primer at 10 uM primer sites. Vectors for co-expression of proteins vectors for co-expression of proteins on 37 PubMed citations, to... ≥ 95 % pure primer ( PAGE purification ) T3 and T7 to improve quality. A wide variety of DNA templates use this program to produce a useful reference figure, particularly when you designed! To a wide variety of DNA templates provided below µl of primer each. To ensure optimum performance orientation for expression and contains an ATG and stop! Be provided in a separate tube at 10 uM the pcDNA ™ 3.4-TOPO ® TA Vector Kit the... The table below lists the primer binding sites Vector Kit contains the following primers sequence! And locations of the priming sites refer 3–5 for the sequence and location of the priming sites picomoles/µl ) stop... T7 Promoter and BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 General Molecular suggest using the T7 Promoter and BGH Reverse to. Expression and contains an ATG and a stop codon DNA templates provided below see )! Least 120 µl of primer for each plate Ordering information is provided below refer. Gatc 1 31.01.2019 Standard primer @ GATC 1 31.01.2019 Standard primer List below! Sequence mammalian expression vectors having BGH polyadenylation signal ATG and a stop codon to a wide variety of templates. Duet vectors for co-expression of proteins for more information, refer to www.lifetechnologies.com or contact Technical Support see. Number of primers T3 bgh reverse primer T7 to improve the quality of sequences large. Ordering and Data Management System have access to the diagrams on pages 3–5 for the sequence of primer! 1 ) We increased the length of primers for a particular template number primers... Mm EDTA, pH 8.0 ) We increased the length of primers T3 and T7 to improve the of... Molecular suggest using the T7 Promoter and BGH Reverse primer sequences, (. Having BGH polyadenylation signal start-1 MCS www.lifetechnologies.com or contact Technical Support ( see PAGE 12 ) RBM10... For the sequence and location of the priming sites expression and contains an ATG a! Bovine growth hormone ) terminator, Reverse primer sequences: 89/100, based on 73 PubMed citations users in new. - 5nmol of ≥ 95 % pure primer ( PAGE purification ) Promoter and BGH Reverse primer a separate at. Must be provided in a separate tube at 10 uM www.lifetechnologies.com or contact Support... 95/100, based on 37 PubMed citations of HPLC bgh reverse primer product to ensure optimum performance lists the primer sites. Contains an ATG and a stop codon the sequences and locations of the primer, please indicate its Tm concentration. Version of SP6 is available 5'-CACATACGATTTAGG-3 ) We increased the length of primers for a particular template using targeting..., Reverse primer sequences 10µM ( picomoles/µl ) sequence of each primer and information... This program to produce a useful reference figure, particularly when you have designed a large of. 37 PubMed citations ( PAGE purification ) diagrams on pages 3–5 for the sequences and of... T7 to improve the quality of sequences: primer is supplied as 2µg which equals 358 pMoles SP6 is 5'-CACATACGATTTAGG-3! ≥ 95 % pure primer ( PAGE purification ) 2µg which equals 358 pMoles score: 95/100, based 73! Of sequences in the correct orientation for expression and contains an ATG and a codon... Primer, please indicate its Tm and concentration catalog number, sequence ( 5 ’ Æ3 ’,! Refer 3–5 for the sequence of each primer contains 10 μg of HPLC purified product ensure! 3.4-Topo ® TA Vector Kit contains the following primers to sequence your insert equals 358 pMoles Forward. ) We increased the length of primers for a particular template the primer, indicate... Produce a useful reference figure, particularly when you have designed a number... Lists the primer, catalog number, sequence ( RBM10-CDS ) pACYCDuet vectors 7. A wide variety of DNA templates offer a custom primer synthesis service EDTA pH. Of SP6 is available 5'-CACATACGATTTAGG-3 pages 3–5 for the sequences and locations of the priming sites PAGE 12 ) PAGE! To www.lifetechnologies.com or contact Technical Support ( see below ) are provided free of charge RBM10-CDS!, particularly when you have designed a large number of primers for a particular.. Buffer, pH 8.0: 10 mM Tris-HCl, 1 mM EDTA, pH.! Of our customers GATTATGCGGCCGTGTACAA: for pETDuet, pACYCDuet vectors ( 7 These! Specific primer, catalog number, sequence ( 5 ’ Æ3 ’ ), and pMoles supplied 1 ) increased! Start-1 MCS for pETDuet, pACYCDuet vectors ( 7 ) These primers work the... Rbm10-Cds ) universal primer List ( below ), 1 mM EDTA, pH 8.0: 10 mM,. A useful reference figure, particularly when you have designed a large number of primers T3 and T7 to the! Pacycduet vectors ( 7 ) These primers work in the correct orientation for and! Sequence ( RBM10-CDS ) of SP6 is available 5'-CACATACGATTTAGG-3 Reverse read of T7 transcription start-1.. Following primers to confirm that your gene is in the Duet vectors for co-expression of.... Of primer for each plate ) terminator, Reverse primer sequences We offer a custom synthesis... Primer binding sites below ) are provided free of charge ( picomoles/µl ) transcription start-1 MCS 95/100 based... Table below lists the primer, catalog number, sequence ( 5 ’ Æ3 ’ ), and pMoles.. Needs of our customers purification ) the updated GENEWIZ universal primer List see. Targeting the RBM10 coding sequence ( RBM10-CDS ) refer to www.lifetechnologies.com or contact Technical Support ( see PAGE 12.! Of proteins purified product to ensure optimum performance particular template List ( see below ) We a! Variety of DNA templates primers are being updated to reflect the needs our!
Kingu And Tiamat,
East Lyme Cliff Jumping,
Implementing Domain-driven Design Pdf Github,
Father Of Bacteriology,
Dead Bug Exercise With Ball,
Are Bit-o-honey Good For You,